liamharvey's blog

I used AncestryDNA for my genetic testing. To have your DNA tested, you send a saliva sample to their labs and results are posted several weeks later. They test your DNA using microarray-based autosomal DNA testing. A microarray is basically a grid of many known DNA segments which then are used to test and map out the DNA sample in question. The microarray used by Ancestry surveys your DNA at 700,000 locations to help find your heritage.

AncestryDNA has an extremely large database not only for DNA testing, but of public records. Here Ancestry can help you create a family tree by using things like U.S. Census records and marriage certificates to link your ancestors. This service can tell you about generations of ancestors, showing you what they did, where they lived and much more. You can start by simply putting you parents and grandparents names into a tree that you create. By adding their name, birth/death dates and birth place, Ancestry will search its database for records of these family members and provide you with a “hint”. By using the hints that Ancestry finds for you, it can help you find older generations like great grandparents. You may also add a family member to your tree that is on someone else’s tree and then you can be linked to their tree which will show much more family members. Using the resource Promethease, I was able to take the raw genomic DNA provided by Ancestry and get a report of what my DNA indicates. Promethease uses my DNA genotypes and compares it with findings that are cited from scientific studies in the website SNPedia.

Over the past few years, mail-in DNA testing kits have become exceptionally popular. These kits can be used in several ways. Some kits are focused for those who wish to learn more about their family history. People can use these testing services, which use their DNA to compare in massive proprietary databases, to discover where their family comes from. My own DNA showed ethnicity estimates in seven different regions. I had always thought I was almost completely Irish, but thanks to my DNA test, I now know that is not the case. Websites like AncestryDNA can also be used to help you create a family tree which, with the help of U.S. Census reports and other documents, can trace back your family for generations. I was able to find out about family members from five generations back. Your family tree can also become linked to other family trees when you have ancestors in common. AncestryDNA will also use you DNA test to find other members that your test indicates you are related to you. Ancestry found 159 predicted third and fourth cousins from my test. Other Websites, like 23 and Me, can analyze your DNA to inform you about health conditions. This can be taken further by using you genomic DNA in the website Promethease, which uses studied SNP’s to tell you what your genotype indicates. Here you can find out if you’re more of less likely to have certain diseases. Other SNP’s will indicate if things such as your muscle fiber make up.

Over the past few years, mail-in DNA testing kits have become exceptionally popular. These kits can be used in several ways. Some kits are focused for those who wish to learn more about their family history. People can use these testing services, which use their DNA to compare in massive proprietary databases, to discover where their family comes from. My own DNA showed ethnicity estimates in seven different regions. I had always thought I was almost completely Irish, but thanks to my DNA test, I now know that is not the case. Websites like AncestryDNA can also be used to help you create a family tree which, with the help of U.S. Census reports and other documents, can trace back your family for generations. I was able to find out about family members from five generations back. Your family tree can also become linked to other family trees when you have ancestors in common. AncestryDNA will also use you DNA test to find other members that your test indicates you are related to you. Ancestry found 159 predicted third and fourth cousins from my test. Other Websites, like 23 and Me, can analyze your DNA to inform you about health conditions. This can be taken further by using you genomic DNA in the website Promethease, which uses studied SNP’s to tell you what your genotype indicates. Here you can find out if you’re more of less likely to have certain diseases. Other SNP’s will indicate if things such as your muscle fiber make up.

My family history went back several generations. On my father’s side of the family, we could only trace back to my grandparents. My grandmother, Rita Harvey, was an orphan and never knew her parents. My grandfather, Michael Harvey, was not adopted but I could not find any family history for him. They were both from Ireland and the databases are not as big and don’t go as far back as they do in the U.S.

               On my mother’s side of the family, a great amount of tracing back was able to be done. My mother’s parents were Edwin Cavanagh and Jackie Joy Singer. On my Jackie’s side of the tree, I was able to find out her parent’s names were William Singer and Hilda Victory. This part of the family was found to come from Texas (William) and Louisiana (Hilda). Which I found interesting because I had always thought the family had been all located in New York after coming to America from Ireland.

            After selecting primers for our gene, they were ordered from an outside lab source. The primers came back from this lab in 12.5 µL concentrations. Our extracted DNA had to be diluted first by adding ~5 µL of extracted DNA to ~45 µL of T₁₀E₁. However, Mutant B was found to be of very low concentration when run in the Nanodrop. For Mutant B only, no T₁₀E₁ was used to dilute the DNA sample and 2 µL of DNA was used alone instead. For Wild Type A, which had an initial concentration of 532.3 ng/µL, 5 µL of DNA was added to 45 µL of T₁₀E₁. For Wild Type B, with an initial concertation of 360.7 ng/µL, 7.5 µL of DNA was added to 42.5 µL of T₁₀E₁. For Mutant A, an initial concentration of 619.1 ng/µL, 4 µL of DNA was added to 46 µL of T₁₀E₁. With this exception, we calculated the diluted concentrations of each sample; Wild Type A had a diluted concentration of 53.23 ng/µL, Wild Type B 54.11 ng/µL, Mutant A 49.53, and Mutant B 2 µL undiluted at 6.5 ng/µL.

            DNA extraction was performed with our two mutant and two wild type plants. We followed the typical DNA extraction protocol which we previously performed. Once DNA was extracted, A typical PCR protocol was set up in the PCR thermocycler. This protocol called for the first step of 95 °C for 30 seconds to allow time for the PCR tubes to be placed into the thermocycler. Step 2 was the melting step which was set to 95 °C for 15 seconds. Step three was the annealing step, which we found by subtracting ~5 °C from the lower Tm of our two primers which was 59.4 °C, so this step was set to 54.4 °C for 30 seconds. The fourth step was the extension step, which we set to 72 °C for one minute. Step five called for a GoTo step to step to, to repeat steps 2-4 for 29 times. Finally, step six was the end step. These steps were input into the thermocycler and our program was saved as “MHN” in the class folder. After the program was set up, our DNA product from extraction was quantified using Nanodrop as done in previous labs.

            Using the online software Primer3, a primer for the gene was found. To do so, the genomic sequence of our unknown gene was put into the first box. The options for left and right primer was left selected. The sequence was named “MHN” in the Sequence ID box. In the box Product Size Range, 500-1000 was selected. Under General Primer Picking Conditions, the parameters were set to: Min = 20, Max = 27, Opt. = 23 for primer size and Min = 65 °C, Max= 70 °C, and Opt. = 67 °C in the “Primer Tm” box. A region of the gene was chosen to be amplified, this region had to include the mutation, was about 200bp from one of the primers and in a restriction site. Primer3 provides five primers, with the top one considered to be the best. With these five options, a primer was chosen based on how well it fit to the previous criteria. The chosen primers were then named “oMHN_L” (GTCCTCCGTCCACCAGTCCTT) and “oMHN_R” (GGTTCCAATGTCCAGCCTCTTGATTT) for the left and right primer’s respectively.

Using Phytozome, the original genomic sequence for our gene was searched in BLAST. The options Mutation Sites (v2) and Reference Sequence were selected.  Here the gene of interest was shown within the B. distachyon genome. Underneath the gene, several diamonds marked sites of mutations. Blue diamonds signified low impact mutations, yellow showed moderate and red showed high impact mutations. Five mutations within coding sequences were selected, including any high impact mutations. By clicking on each diamond, the mutation’s location was found. Zooming in enable the wild type and mutation reading frame to be seen and what change in sequence the mutation caused. The position and orientation of each mutation was added to our working map. A figure was then made on PowerPoint showing the position and mutation effect of each mutation relative to its location on the gene.

Using the gene sequence from Sanger sequencing, we compared our gene sequence with several related species. Five species were used, including B. distachyon, and well explored genomes such as O. sativa, which like B. distachyon is a grass species. We also compared our gene with the eudicots A. thaliana and S. lycopersicum.  A. thaliana’s genome is very well studied, and its genes are closely related to B. distahcyon’s. A. trichopoda is considered a sister of flowering plants and was also used. Once again, we used NCBI to align these species; a PSI-BLAST compared our genes amino acid sequence with genes in these five species.  We then used a program called MAFFTA. We took the PSI-BLAST results and used the MAFFTA software to create a phylogenetic tree of our gene and related genes from those five species.  Here we could explore our genes evolutionary relationship with similar species’ genes and using closely related genes, find further clues about our genes function. Finally, we will use two histochemical stains, T-blue and Ph-HCL to observe the polysaccharide and lignin content of our mutant and wildtype stems. We will select regions of the stem which have been predicted to be of high expression in our gene of interest to find if the mutant histology differs from that of wild type.

After having created a working map for our genomic DNA, identifying our gene of interest and doing extensive research on its possible functions, we needed to perform several experiments to find out more about our gene. The purpose of this lab was to use a reverse genetics approach to explore our Brachypodium distachyon gene of interest and its function by experimenting with mutant and wild type samples. We effectively worked from the mutant phenotype to explore the gene’s function. In doing so, we took several approaches to examine the phenotype, genomic DNA, phylogenetic relationships, and histology of the samples to identify the gene’s possible functions.