383 lab 3 methods p 2

            Using the online software Primer3, a primer for the gene was found. To do so, the genomic sequence of our unknown gene was put into the first box. The options for left and right primer was left selected. The sequence was named “MHN” in the Sequence ID box. In the box Product Size Range, 500-1000 was selected. Under General Primer Picking Conditions, the parameters were set to: Min = 20, Max = 27, Opt. = 23 for primer size and Min = 65 °C, Max= 70 °C, and Opt. = 67 °C in the “Primer Tm” box. A region of the gene was chosen to be amplified, this region had to include the mutation, was about 200bp from one of the primers and in a restriction site. Primer3 provides five primers, with the top one considered to be the best. With these five options, a primer was chosen based on how well it fit to the previous criteria. The chosen primers were then named “oMHN_L” (GTCCTCCGTCCACCAGTCCTT) and “oMHN_R” (GGTTCCAATGTCCAGCCTCTTGATTT) for the left and right primer’s respectively.