Perfect Paragraph

Our results yield an outcome that refutes the prior hypothesis we had made. Because a lower Shannon Index results in a higher species diversity, we would have expected that the Sylvan area would have a lower number than Orchard Hill. Our results give us a Shannon Index for Sylvan that is higher than that of Orchard Hill, telling us that the area around the Hill has a higher species diversity than Sylvan. While these results don’t match our expectations, there are a few explanations as to why. First of all, the area around Orchard Hill may be more ideal for plant life (ex. less predators, easy access to rain). From the blind eye, we pointed the stream in Sylvan out as a huge factor favoring species diversity- yet other factors may have also been in effect. Another reason for our results can be due to the method and how the experiment was conducted. This experiment was very open to human error, and the results may not have been completely correct. Identifying, counting, and making sure to stay in the area allotted was difficult to do; and it was hard to collect data without injuring the environment around us by trampling over everything. We had originally set out to get at least 15 different species from each area, which ended up being tough to do.

    Dog Day Cicadas are one of the most common species of cicadas found in the United States. Research has shown that they use a specific mating call in order to attract females in hopes of performing reproduction. The sound is created by the panels beneath their wings, known as tymbals. The panels vibrate rapidly, and the sound is then intensified by the cicada’s mostly hollow abdomen. The main mating call is a high-pitched drone that lasts about 15 seconds, starting off softly and gradually growing louder into a crescendo, and then tapering off by the end. The sound is eerily similar to the sound of an electric saw. Female and male cicadas can also create sounds using their wings, but this sound is different and distinct. The reasoning for using this sound is unknown. We would like to determine whether or not this signal is also a part of the mating call, or is instead used in a different manner. Cicadas are not known for communicating anything other than their desire to mate, and our team would like to determine what else Dog Day Cicadas are trying to communicate. Resources available include data from the Texas A&M Forest Services, studies done by the University of Wisconsin Milwaukee, and other research journals done by the University of California, Irvine.

Topocloning is a faster and more efficient version of the traditional cloning method. Cloning is the process by which a DNA sequence of interest is integrated into a vector plasmid. This is done traditionally by cutting the plasmid with a restriction enzyme and then ligating either end of the sequence to the open ends of the plasmid. The ligation step is performed by an enzyme called ligase. The use of two different enzymes in two different steps makes the traditional cloning method ineffective. Many errors occur using this method. The advent of topocloning has circumvented the use of two enzymes and reduced errors, by the use of a single enzyme called topoisomerase 1. The vector comes open with two toposiomerase 1 enzymes on either end of the open vector. Once the sequence of interest comes into the gap, the topoisomerase 1 enzymes catalyze the ligation step, closing up the vector and integrating the appropriate sequence into the vector.

Biodiversity is a term used to describe all species in an environment that coexist (Alteiri, 1999). Biodiversity creates a stable ecosystem by offering protection and regulation to crops making the diversification essential for prosperity (Elings, 2017). Specifically, in agricultural systems, the organisms contribute to the reuse of nutrients and enhance soil fertility (Alteiri, 1999).

    The cheetah (Acinonyx jubatus) is a wild cat found scattered around in small parts of Africa and Iran. It is famous for being the fastest land animal on the planet, able to reach speeds up to 75 miles per hour. There are five subspecies; four that are African and one that is Asian. According to a research paper titled The global decline of cheetah and what it means for conservation by Sarah M. Durant and her team, the cheetah’s historic range was most of Africa (excluding parts of central Africa, Egypt, and Madagascar) and the Middle East into India. Today, cheetahs have lost 98% of their range in Asia, and the Asian Cheetah (Acinonyx jubatus venaticus) is critically endangered with an estimated 50 individuals. In Africa, the remaining four subspecies live only on 13% of the land they once inhabited, causing the Northwest African Cheetah subspecies (Acinonyx jubatus hecki) to also become critically endangered. As of 2014, the known cheetah population is about 6700 individuals over 29 subpopulations (Durant).

The reaction of plants to stress from their environment involves a series of pathways which induce defenses (Tian et al. 2014). These pathways involve several hormones which trigger the defense responses in plants. Jasmonates are stress-induced phytohormones that incorporate biotic and abiotic cues that regulate plant growth, development, and defense responses. Jasmonic acid is a hormone plants release to control the responses from herbivore consumption. While impeding growth, the application of jasmonic acid to plants has been shown to enhance the treated plant’s natural defenses (Huang et al. 2017).

Sanguivory is a dietary habit that involves feeding on blood. While a lot of sanguivorous animals will substitute their diets with food from other sources, some are obligate sanguivores and can survive on a diet of blood only. An example is the vampire bat, and there are three species that are obligate sanguivores: the common vampire bat (Desmodus rotundus), the hairy-legged vampire bat (Diphylla ecaudata), and the white-winged vampire bat (Diaemus youngi). There have been multiple theories about the evolution of vampire bats, including that they may have evolved from frugivorous, carnivorous or nectarivorous ancestors, but recent analysis has suggested that they are descended from insectivores. Blood is a very challenging food source, and so requires specialized adaptations in both anatomy and physiology. Vampire bats have short, cone-shaped muzzles and incisors and canines that are specialized for cutting, and they are very maneuverable on land, and can walk, jump, and run by using their forelimbs. Although the gut microbiome of the common vampire bat is taxonomically more similar to insectivorous and carnivorous bats than to frugivorous (fruit-eating) bats, and although insectivorous, carnivorous, and frugivorous bats all have similarly functioning gut microbiomes, vampire bats have gut microbiomes that are unique. A study on “Hologenomic adaptations underlying the evolution of sanguivory in the common vampire bat” (Mendoza et al. 2018) suggests that the function of the microbiome may be influenced more by phylogeny than taxonomy, and that the vampire bat’s gut microbiome is specialized for its demanding diet.

For our treatment, we will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is known to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and the miR-155 sponge will be the one used by Kluiver and colleagues (2012), which will be the reverse transcribed version of the complement to this RNA strand.  By inserting miR-31, the SATB2 protein will be repressed. Repression of SATB2 means that transcription of CAF genes involved in tumor epithelial to mesenchymal transition will be repressed. By inserting the miR-155 sponge, the overexpression of miR-155 will be irrelevant, because it will be sequestered. The mechanism of miR-155 upregulation in CAFs leading to tumor cell progression is unknown, however it has been shown to reverse the CAF phenotype (Mitra et al 2012.)