miRNA Ovarian Cancer Treatment

For our treatment, we will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is known to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and the miR-155 sponge will be the one used by Kluiver and colleagues (2012), which will be the reverse transcribed version of the complement to this RNA strand.  By inserting miR-31, the SATB2 protein will be repressed. Repression of SATB2 means that transcription of CAF genes involved in tumor epithelial to mesenchymal transition will be repressed. By inserting the miR-155 sponge, the overexpression of miR-155 will be irrelevant, because it will be sequestered. The mechanism of miR-155 upregulation in CAFs leading to tumor cell progression is unknown, however it has been shown to reverse the CAF phenotype (Mitra et al 2012.)