ewinter's blog

For the treatment regarding the three miRNAs in ovarian cancer associated fibroblasts, I tried to elucidate the downstream targets by which these epigenetic changes of mi-RNAs in CAFs induce epithelial to mesenchymal transition of cancer cells. By reading the literature, I found and described a few pathways. Despite these known pathways, the mechanisms by which mi-RNAs lead to epithelial to mesenchymal transition are likely far more complicated. Mi-RNAs are short, approximately 20 bases in length. Therefore, they are interesting because they often have binding specificity for thousands of genes, meaning they can downregulate the expression for all of these genes. Therefore, there are likely many more pathways that are unknown. Treatment involving mi-RNAs usually evolves from an observational study about miRNA dysregulation, and the reversal of the cancerous phenotype having anti-cancer effects. These studies are sometimes substantial to warrant treatments based on their findings, without figuring out exactly why they work. While it may be startling, proving anti-tumor properties is sometimes enough to garner FDA approval, despite not knowing a mechanism of action. For example, Procarbazine, an FDA approved chemotherapy drug commonly used to treat Hodgkin’s lymphoma, has a mechanism of action that is not fully understood.

The goal of this experiment is to determine whether there is differential expression of the Bradi1g25180 gene between old versus young roots. Seeds were planted in gel and roots were grown for one week. New roots will be defined as the bottom half of the central axis root, while old roots will be defined as the top half of the central axis root. There are eight plants. There will be eight experiments; four of old roots and four of new roots. Each tube will contain either old or young roots from plants 1+2, 3+4, 5+6, or 7+8. The first step is to extract RNA. Once RNA is extracted and quantified using Nanodrop, RT-PCR will be performed. Primers that anneal to exons with an intron in between were made, such that the cDNA product is 261 b.p. long and the gDNA product is 537 b.p. long. This difference will allow us to see differential expression on a gel, because the more cDNA there is, the more RNA was present. High levels of RNA for a gene indicate high expression.

https://eandt.theiet.org/content/articles/2019/04/also-i-hope-we-can-cure-all-disease-interview-with-neurotechnologist-ed-boyden/

This article, published on April 3, 2019, is about Ed Boyden, the founder of optogenetics. This article interests me because I work in a lab on campus in which we use optogenetics. Recognizing that the brain’s neurons communicate using electrical pulses, Ed Boyden wanted to invent a technique to further define the neural circuits in the brain. The technique uses proteins called opsins from natural sources such as bacteria and fungi, that are light-gated ion channels. A neuron is made to expresses these opsins using injection on a viral vector, so when a light is shined on the neuron, it is depolarized and fires action potentials. This technique relates to material in this course because it can be used to further elucidate the neural circuits involved in pretty much everything. For example, in my lab, we are using optogenetics to find the neural circuits involved in sensorimotor gating, something that patients with schizophrenia have an inability to do. If we can find the circuit, we will be better able to design treatments for patients with schizophrenia. In order to further the technique of optogenetics, less invasive applications would be ideal, although these do not exist yet. As Ed Boyden mentions, we need better methods to watch the brain in action. The only way we can do this in the lab right now is by decapitating the mice and harvesting their brains.

For the treatment regarding the three mi-RNAs in ovarian cancer associated fibroblasts, I tried to figure out downstream targets by which these epigenetic changes of mi-RNAs in CAFs induce epithelial to mesenchymal transition of cancer cells. I proposed a few possible pathways, although these are likely far more complicated, and there are likely many more that I did not cover. What makes mi-RNAs interesting is that because they are so short, approximately 20 bases in length, they often have binding specificity for thousands of genes. This means that treatment involving mi-RNAs usually evolves from an observational study about mi-RNA dysregulation, and the reversal of that phenotype having anti-cancer effects. With mi-RNA treatment, it is often the case that it is discovered that reversal of the phenotype is effective in treating cancer, without figuring out exactly why, because the possibilities are so vast.

ELISA will also for HK2 and PKM2, as these should be downregulated if the Ginsenoside 20(S)-Rg3 treatment worked. Since ovarian cancer metastasizes so quickly and mutates in unpredictable manners, we would biopsy each site of metastasis for the primary tumors, and each new metastasis as well. The microenvironment of each individual tumor has the possibility to be different, and the biopsies will aid us in understanding if CAFs, immune cells, or other social microenvironment based cells are becoming amplified. The biopsy results from distant metastatic sites will also provide insight into what kind of mutations the cancer is undergoing.

The Anas platyrhynchos behavior will be characterized according to an ethogram developed using elements from Mason (2013) and Welsh (2017). The nine behaviors are: (1) locomotion on land (walking); (2) locomotion on water (swimming); (3) locomotion in air (flying); (4) resting/comfort on land (sleeping, loafing, body maintenance); (5) resting/comfort on water (sleeping, loafing, body maintenance); (6) feeding in water (7) feeding on land (8) alert (cessation of activities, upright posture) (9) aggression (chasing, pecking, other aggressive behavior). At their assigned time, every day for the two week period of April 7, 2019 to April 21, 2019, each group will stand at the minuteman statue on the west side of the pond and capture a 10 second video in landscape mode using a long range video camera borrowed from the DuBois Library. The frame of view will continuously shift while capturing the video so a 180 degree view of the campus pond is obtained. The groups will watch the video and assign one of the behaviors above to each Anas platyrhynchos present in the video.

There will be nine observational conditions: (1) ‘time of day’ recorded as 6:00, 8:00, 10:00, 12:00, 14:00, 16:00, 18:00, 20:00, 22:00; (2) ‘weather’ recorded as either ‘sun,’ ‘clouds,’ or ‘precipitation; (3) ‘temperature’ recorded to the nearest degree Celsius by the Wadsworth control service at UMass Amherst. (4) ‘number of humans passing per minute’ will be recorded by standing at the minuteman statue on the west side of the campus pond and counting the number of humans passing by in either direction in a one minute timeframe; (5) ‘number of Branta canadensis’ will be the number of visible Branta canadensis when standing at the minuteman statue; (6) ‘day of week’ will be recorded as ‘Mon’ ‘Tu’ ‘Wed’ ‘Thu’ ‘Fri’ ‘Sat’ ‘Sun,’ (7) ‘number of Anas platyrhynchos’ will be recorded as the number of visible Anas platyrhynchos observed when standing at the minuteman statue; (8) ‘location’ will be the quadrant in which the majority of Anas platyrhynchos are located on the pond or on land and will be recorded as either ‘A’ the northwest, ‘B’ the northeast, ‘C’ the southwest, or ‘D’ the southeast; (9) ‘fountain’ will be recorded as ‘on’ if the pond fountains are on, or as ‘off’ if they are off. Each of the nine groups will be assigned a time of day (6:00, 8:00, 10:00, 12:00, 14:00, 16:00, 18:00, 20:00, or 22:00), and will collect data for each condition at that time of day for the two week period of April 7, 2019 to April 21, 2019.

For our treatment, we will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is known to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and the miR-155 sponge will be the one used by Kluiver and colleagues (2012), which will be the reverse transcribed version of the complement to this RNA strand.  By inserting miR-31, the SATB2 protein will be repressed. Repression of SATB2 means that transcription of CAF genes involved in tumor epithelial to mesenchymal transition will be repressed. By inserting the miR-155 sponge, the overexpression of miR-155 will be irrelevant, because it will be sequestered. The mechanism of miR-155 upregulation in CAFs leading to tumor cell progression is unknown, however it has been shown to reverse the CAF phenotype (Mitra et al 2012.)

We will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is know to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and we will add the miR-155 sponge used by Kluiver and colleagues (2012).

We will use the drug J113863, a CCR1/3 receptor antagonist. Mitra and colleagues showed that this drug successfully blocked the homing of ovarian cancer cells to normal omental fibroblasts transfected with anti-miR-214 and anti-miR-31- an induced CAF phenotype. We will deliver this on the biopolymer sheet. The biopolymer sheet will be put directly on the omentum during surgery. This delivery method will allow introduction of the drug directly on its target - the omental fibroblasts and any metastatic cancer cells. CCL5 will be unable to bind to its receptor and therefore the receptor will not transduce the signal to the NF-kB signaling pathway, which therefore will inhibit the epithelial to mesenchymal transition of ovarian cancer cells.