We will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter. To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is know to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org. We will add the sequence for miR-31 as given, and we will add the miR-155 sponge used by Kluiver and colleagues (2012).
Recent comments