Drafts

The study that was conducted was done on mice and its behavior when oxytocin was injected into the mice. Before the injection, the mice were studied, especially their behaviors and how the mothers would treat its children. When oxytocin was injected into the bodies the mother's behavior changed. The mothers started acting more loving towards their children. Oxytocin is boosting the neural signal in the brain that assists in social cues and moments of distress. Oxytocin is the hormone that is released when mice are stress to assist in calming the mice down. When the mother finds that the children are under stress the oxytocin released assists in their increased attention and care towards the children.

1.011 grams of nutmeg and 3 mL of TBME were added to a round bottom flask. The solution was gently boiled in an air distillation apparatus for 10 minutes and then cooled to allow the solids to settle. A micro-scale filtration apparatus was used to filter the liquid into a tared 25 mL flask. To remove the rest of the solid from the flask another 2 mL of TBME was added to the flask and heated briefly. The remaining solution was filtered through the micro-scale apparatus again. The solution was dried gently with air until the solvent evaporated and only the crude trimyristin remained. The crude product was dried before being weighed (0.704 grams) and recrystallized. 6 mL of acetone was added to the flask with the crude product and the solution was heated until the solid product dissolved completely. The solution was then cooled for 5 minutes to room temperature and then placed in an ice bath for 15 minutes allowing crystals to form. The crystals were collected via vacuum filtration and rinsed with 1 mL of acetone. In a clean round bottom flask 0.06g of trimyristin, 2 mL of 6M NaOH, and 2 mL of 95% ethanol were added. The solution was refluxed for 45 minutes. While the solution was being refluxed a second recrystallization was performed on the remaining trimyristin product. After the reflux was competed the solution was cooled to room temperature and then added into a 50 mL beaker with 8 mL of water. 2 mL of HCl was added dropwise to the beaker while stirring. The final solution was cooled in an ice bath for 10 minutes and vacuum filtered to produce 0.046 grams of myristic acid.

 The starting materials were reacted to obtain a crude trimyristin product. Trimyristin was obtained in a 82.9% yield. The final product, myristic acid, was obtained at a 80.9% yield. The products were identified and compared using melting points. The melting point of the first recrystallized product was 56°C compared to the melting point of the second recrystallization of 58°C.  Comparing these two melting points it is clear that the more times a recrystallization step is performed then the closer the experimental melting point is to the theoretical melting point. The melting point of the myristic acid was found to be 53°C which is comparable to the actual melting point of 54°C.

One permaculture principle that can be applied to this intervention is Observe and Interact. We used it by observing how much water toilets waste per flush, combined with about how many times people go to the bathroom every day. Then, we came up with the idea of more eco-friendly toilets that could be implemented to save a lot more water, and in turn, reduce costs. Another permaculture principle that we used to plan our idea was Use and Value Renewable Resources and Services. The renewable resource in this case is fresh, clean water, which we have limited supply of. Since water is so valued, we should make an effort to contaminate less, so toilets that use less water to flush waste would be best. By adding more efficient toilets, less energy and fossil fuels is also used to clean the water in water treatment plants, further reducing waste and pollution. A third permaculture principle we used was Design from Patterns and Details. We observed that each day, people mostly go to the bathroom in the dorm at two major times, in the morning, and night. That is the time when people usually do their business before class, or bed. Another pattern we observed was the amount of flushing. Students would do either two things, flush, using a lot of water, or just not flush, leaving behind a disgusting mixture of their waste for the next person to discover. By installing low-flush toilets, people can always flush, reducing water usage, while also creating a cleaner bathroom.

The Notch pathway is highly conserved and involved in both cell proliferation and apoptosis. There are five ligands involved: Delta-like ligand 1 (DLL1), DLL2, DLL4, Jagged 1 (JAG1), and JAG2. When the ligands bind to the Notch receptor, the intracellular domain (NICD) is cleaved by ADAM, a disintegrin and metalloproteinase as well as γ-secretase (Wong et al. 2019). After NICD is released, it is able to bind to a translational complex and initiate transcription of proteins that either influence proliferation or apoptosis. Vascular endothelial growth factor (VEGF) signaling also contributes to tumor angiogenesis and works in collaboration with Notch ligand DLL4 to further the cancerous phenotype. More specifically, overexpression of ligands DLL4 and JAG2 have been found in pancreatic adenocarcinoma (Gao et al. 2017). Targeting of both these ligands, as well as VEGF, is therefore crucial in halting self-renewal of PaCSCs. It has been shown that elevated expression of DLL4 leads to therapeutic resistance against VEGF receptors, making a synergistic approach to targeting these two more appealing (Takebe et al. 2015). The bispecific antibody targeting DLL4 and VEGF receptors, Navicixizumab, is currently under clinical trial for colorectal and ovarian cancer, and the PancreAss Kickers plan to incorporate it into their treatment as well (OncoMed Pharmaceuticals 2018). A similar bispecific antibody to target overexpressed JAG2 and VEGF receptors can also be developed and incorporated into the treatment to stop the self-renewal PaCSC process.

We will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is know to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and we will add the miR-155 sponge used by Kluiver and colleagues (2012).

Scientists conducted an experiment to test the levels of trustworthiness with testosterone and women. A placebo and testosterone was administered to trustworthy women and untrustworthy women. Oxytocin is a hormone that is released in a pulsatile manner, often when a person makes physical contact with someone else. When a person comes into contact with someone else the hormone is released into the bloodstream. The hormone causes relaxation, positive moods and trust. What scientists found was that the testosterone in females caused a decreased level of trust in women. Which is caused by a decrease in oxytocin levels.

A polysaccharide called glycogen plays a key function in energy storage in animals. It is a homoglycan of glucose and is highly branched for efficient storage and release of glucose. Glycogen is mainly stored in the liver and muscle cells, the liver being the regulator of blood glucose levels and the muscle requiring the breakdown of glucose for energy for muscle contractions. Glycogen is synthesized through three main enzymes. Glycogenin forms glucose primers of at least four monomers, catalyzing the addition of glucose chains to its aspartic acid R-groups. Glycogenin is required to start all new glycogen molecules. Then, glycogen synthase catalyzes the addition of glucose to the primer one at a time through alpha (1,4) bonds. Next, the branching enzyme forms the branches of glycogen. It transfers a minimum of seven-unit chains of glucose, breaking an alpha (1,4) bond, and connects them to another chain through an alpha (1,6) bond. On the other hand, glycogen degradation occurs using two main enzymes. Glycogen phosphorylase removes monomers from non-reducing ends up until four units away from a branch point. Then, the debranching enzyme removes the three-unit chunk from the branch and attaches it to the main chain. It can then break the alpha (1,6) bond to remove the branch point glucose. This allows for glycogen phosphorylase to continue to degrade the chains of glucose.

One of the first aneuploids to be recognized was a fruit fly with a single X chromosome and no Y chromosome, discovered by Calvin Bridges in 1913. Another early study of aneuploidy focused on mutants in the Jimson weed (Datura stramonium). A. Francis Blakeslee began breeding this plant in 1913, and he observed that crosses with several Jimson-weed mutants produced unusual ratios of progeny. For example, the globe mutation (which produces a globe-shaped seedcase) was dominant, but was inherited primarily from the female parent. When globe mutants self-fertilized, only 25% of the progeny had the globe phenotype. If the globe mutation were strictly dominant, Blakeslee should have seen 75% of the progeny with the trait, so the 25% that he observed was unsual. Blakeslee isolated 12 different mutants that exhibited peculiar patterns of inheritance.

Carbohydrates are one of the main biomolecules in organisms. They are made up of monosaccharides, the monomer units of carbohydrates. Monosaccharides share a common chemical formula consisting of carbons, hydrogens, and oxygens, and there are two types based on the different functional groups. An aldose such as glucose contains an aldehyde at the end of the carbon chain, while a ketose such as fructose has a ketone group within the chain. These monosaccharides have different properties because of these differing structures. Monosaccharides with four or more carbons are mainly rings. A ring forms through a reaction between a hydroxyl group and carbonyl carbon, resulting in a chiral anomeric carbon. Depending on the orientation of the hydrogen in the produced ring, the ring has either an alpha or beta conformation. Monosaccharides are then connected by glycosidic bonds, which form through the dehydration reaction between the anomeric carbon and a hydroxyl group. Since they are formed through dehydration, glycosidic bonds are also broken through hydrolysis. Longer chains of monosaccharides are referred to as polysaccharides.