Drafts

Management and economics of energy are important for fitness. Animals allocate resources for reproduction, growth, and maintenance. R type species have short life spans and lots of reproduction while K type species have long life spans and produce few offspring that they invest a lot of energy into. The rate of energy usage is also an important consideration. The rate of energy usage determines how quickly an organism will go through their stored resources and how much food is required to get from the environment. Organisms have unique physiological and anatomical traits that help them manage energy acquisition, storage, and utilization.

The NaN1898_Bd1_70884553_Het mutation was located on the Bradi72430 gene as a point mutation converting a guanine to adenine. Through Primer 3, primers for PCR of the mutation site were identified: GGGGTTCTTGTCTGCGCTCTGGT (left) and GCACACGAGAGGAAAACGACCGC (right). The primers were for a product of 928 bases, and the mutation was 134 bases away from the left primer (Figure 1).

DNA was successfully extracted from six mutant plants and two wildtype plants. PCR of this DNA was performed with an annealing temperature of 66°C. The resulting PCR products were visualized via gel electrophoresis. Bands on the gel of PCR products diluted double distilled H2O (Figure 2) were much more prominent, indicating higher DNA content than PCR products diluted with T10E1 (Figure 3). Bands were present in lanes 2-5 and 7-8 of both gels about 3.5 cm from the wells. There were no bands in lanes 6 and 9 of both gels. Bands in lanes 2-5 (mutants 1-4) of gel 2 were the brightest and least smeared overall, so these were used for extraction and purification. Once extracted and purified, the DNA of mutants 1 proved to have the highest DNA content (Table 1). The A260/A280 ratios revealed the DNA of mutants 1 and 4 to be relatively pure, with ratios close to 2.0. DNA from mutants 2 and 3 were more contaminated. These four samples of extracted and purified DNA were sent for Sanger sequencing.

This was for the same talk at harvard. This talk was incredibly interesting and focused on how cells grow in a defined rod shape. The purpose of the talk was to explain how cells maintained a uniform width while expanding from a spherical shape to a rod shape. The organism used in the study was Bacillus subtilis, it was used because it is a rod shaped cell. The average width of the rod shaped B. subtilis is 740 nm, this value only varies by 1% and makes it an ideal organism for this study. Knowing that this organism has a uniform width shared by all individuals the question was then asked, how does this organism regulate the width of its rod shape? The way that this was tested was by changing conditions of cell growth, using antibiotic to target certain cellular mechanisms, as well as up regulating and down regulating certain genes within the rod complex (this complex is known to be associated with rod shaped growth of cells). One condition which the cells were exposed to was a salt shock, the salt causes the cells to shrink. This process was used to determine shrinking rates of the cell when mreBCD was upregulated or downregulated. Another condition cells were exposed to was providing more or less nutrients to determine which complexes would be affected by nutrient availability and how that would ultimately affect rod shaped growth. For observing the orientation of cell walls polarization microscopy was used.

The bright bands on the gel indicate that DNA was successfully extracted. This was expected, despite some worry about self complementation due to the “any th” value of 8.16 in the primer3 output. We do not know why lane number 2 on the TE gel did not show a band. We recall loading sample into this lane. It is possible that something in the DNA extraction protocol failed, so no DNA of large band size was extracted. We preferentially chose mutants from the TE gel to send for sequencing because TE stabilizes DNA. All three of the trustworthy sequence results confirmed that the mutant plants were homozygous for the NaN1793 mutation.

By looking at the gels, we decided to extract M1 from H20 because it did not show up on TE. We then chose to take M2, M6, and M7 from the TE gel. After purifying the DNA from the gel using the gel extraction protocol. The concentration of M1 was 30.2 ng/uL. The concentration of M2 was 37.3 ng/uL. The concentration of M6 is 24.1 ng/uL. The concentration of M7 is 25.1 ng/uL. The A260/280 ratios are all near 2.0. This is usually considered pure for RNA. In this case, the fact that they are consistent across all four samples is a good indicator that we have pure DNA.

Cabomba caroliniana, or better known as fanwort, is a perennial aquatic plant. Stems of the plant reach up to 10 meters and are branched. The leaves grow in pairs outward from the stem with fine texture. The stems themselves are rhizomes and leaves that reach the surface are diamond-shaped. Fanwort is native to subtropic-temperate regions of eastern north and south America. It was naturalized in the United States via aquarium trade. Plant fragments easly settle and grow through movements from different bodies of water carried by boits, fishing gear, wind, and currents. The plant is well adapt to grow in a variety of substrates and depths up to 30ft or in shallow waters less than ten feet. A variety of issues concerning ecological relationships and even impacts on humans arise as the density of the plants prevent use of different bodies of water. Furthermore, fanwort displaces native macrophytes and creates shortages of food for native fish.

A Chinese biophysics researcher, He Jiankui, performed germline editing via CRISPR-CAS9 on human embryos in order to make them resistant to HIV. The procedure was done without consent to the babies of course and without the permission from the government. The issue with germline editing is that the effects of the genetic mutation on future generations in not yet known. Should germline gene editing be approved for preventing HIV in humans without confident knowledge in the effect on future generations? In other words is the immediate benefit of germline gene editing worth the potential cost of future generations?

The poster gives some information but also leaves some things out or does not give full explanations for details important to understanding the poster’s content. For example, an explanation of a “monochromatic interaction” is touched upon but not fully explained, or phrased in such a way so as to make it clear that the sentence in question is defining what a monochromatic interaction is. The figure legends also did not include quite enough information for a reader to fully understand what they were showing and what they illustrated about the topic of the poster. The objects included however were all of reasonably good quality, and contributed nicely to the overall appearance of the poster.

The poster is organized into roughly five section: Introduction, Results, Conclusion, References, and Acknowledgements. There is no Abstract or a defined Methods section, part of which seems to have been added to the end of the Introduction. The poster is fairly easy to follow, as all the text is congregated on the left side of the poster and the Figures referenced are either on the right side of the poster in line with the text that mentions them, or are integrated in the text where relevant. However the fact that all the brightly colored figures are separated from, and are yet in line with, the text makes the poster legible. For the most part the information is easy to find, however the section headings are vertically along the edge of the poster which makes figuring out where one section ends and another begins mildly challenging despite the bolded subheadings which attempt to differentiate between sections. Beyond the bolded subheadings there is no real emphasis on any other text. Each section is focused enough to give enough information about the topic, however there is some overlap in the sections, such as where there are some methods mentioned in the introduction. The writing is focused in short sections, none longer than a paragraph. Although the overall tone and style of language is appropriate for scientific writing, there are some grammatical and structural errors in the text, mostly noticeable in the way sentences are put together—the phrasing is often rather clunky in a hard-to-understand kind of way. The amount of text however is suitable for a poster, and it is not overly text-heavy.

In terms of design, the poster is neatly arranged, with a minimal color palette and layout that makes it easy to read and easy on the eyes. The left side of the poster is taken up the main chunk of text that is broken up by sub-headings and three graphs and and two tables, whereas the right side of the poster is almost entirely figures with the “References” and “Acknowledgements” sections at the bottom. There is consistency an intentionality behind the placement of all the objects and the way they are lined up. The only color besides gray and navy is in the figures on the right side of the poster, which have red, blue, green and lavender/pink elements. Both sections of Figure 4 have a gray background, whereas Figure 1 has a white background. Figures 2 and 3, which are integrated into the text on the left side of the poster have navy blue elements, while Tables 1 and 2—also integrated into the text—are in varying shades of light gray. The main title and the headings for each main section (Introduction, Results, and Conclusion) are white text on a medium-gray background, and the authors names and affiliations are black text on a light gray background. The text is a legible size and sans-serif font. The title is the largest, with the headings and subheadings that are slightly smaller. The title is in title case and the headings for the Introduction, Results, and Conclusion are all in uppercase only, while the subheadings are in a slightly different font and are bolded.