Blogs

We will investigate the effect resource petitioning can have upon two species of birds that exist within the same habitat. The goal of this study is to analyze differences between beak size and shape, habitat and how they obtain their food. We will use the University of Massachusetts Amherst avian collection to collect data on bill length, depth, and width from preserved bird skins. We will use this collection because it will allow us to compare beak measurements of different species using a primary source of data. We will also use reliable ornithology research articles to find information on habitat types, behavior, and diet that will be used to compare bird species.

Sanguivory is a dietary habit that involves feeding on blood. While a lot of sanguivorous animals will substitute their diets with food from other sources, some are obligate sanguivores and can survive on a diet of blood only. An example is the vampire bat, and there are three species that are obligate sanguivores: the common vampire bat (Desmodus rotundus), the hairy-legged vampire bat (Diphylla ecaudata), and the white-winged vampire bat (Diaemus youngi). There have been multiple theories about the evolution of vampire bats, including that they may have evolved from frugivorous, carnivorous or nectarivorous ancestors, but recent analysis has suggested that they are descended from insectivores. Blood is a very challenging food source, and so requires specialized adaptations in both anatomy and physiology. Vampire bats have short, cone-shaped muzzles and incisors and canines that are specialized for cutting, and they are very maneuverable on land, and can walk, jump, and run by using their forelimbs. Although the gut microbiome of the common vampire bat is taxonomically more similar to insectivorous and carnivorous bats than to frugivorous (fruit-eating) bats, and although insectivorous, carnivorous, and frugivorous bats all have similarly functioning gut microbiomes, vampire bats have gut microbiomes that are unique. A study on “Hologenomic adaptations underlying the evolution of sanguivory in the common vampire bat” (Mendoza et al. 2018) suggests that the function of the microbiome may be influenced more by phylogeny than taxonomy, and that the vampire bat’s gut microbiome is specialized for its demanding diet.

    There are two main types of people, either you are a morning person who likes to sleep early and wake up early, while others like to wake up late, and sleep late. Is there a better version to be? The answer as of right now, is actually being a morning person. The reason why is because society was built on the premise of waking up early, getting to work, and finishing by the evening to enjoy the rest of the day. This means that those who are naturally morning birds, are able to work with the flow of society, and get the most out of it; while those who are night owls tend to have a lot of difficulty getting up for work in the morning. There’s been very recent research done that shows a strong disparity between minorities and caucasians, demonstrating that on average those who are caucasian or of latino descent, tend to be morning birds while those who are from asian or european descent, tend to be night owls. The research points to how our ancestors were used to a different type of circadian rhythm, and while the place we live in plays a major role in how we sleep and when we like to wake up, it’s possible that we have genes that are programmed for us to sleep  and wake up at specific times based off where our ancestry’s from.

Biodiversity is an important feature in any ecosystem, and lawns are no exception. The data obtained from this study will not only offer some insight into the effects of common maintenance practices on lawn biodiversity in Amherst, Massachusetts, but will also set the stage for more research that could be done on the topic. The data will be a useful aid in future decisions both about how lawns should be maintained, and about how these practices can be used to aid in the conservation of the natural plant diversity in Amherst. It can also provide a framework for efforts to slow the decline of biodiversity in green spaces, for example by highlighting which areas have the most biodiversity and how that correlates with how these areas are maintained. This can allow for individualized tailoring of maintenance practices for each lawn or green space based on the plant species that inhabit it, and also provide information about which areas could benefit from the introduction of new species to increase the floral diversity.

    Everybody has a different approach when it comes to studying for an exam. Some people will take weeks before an exam and study bits and pieces until the day of the exam, and others will wait until the day of the exam to start studying. It starts to beg the question, which method is the ‘correct’ method? Research has actually shown that on average, studying 4 to 6 days in advance for any exam is most likely the best way to study for an exam. The first 3 to 4 days are used to study the material in parts, and by the end of the 3rd or 4th day, all the material will have been sufficiently reviewed. Come the following 5th and 6th day, those days are used as days to comprehensively review the material. The reason why research supports this method of studying, is because of the amount of sleep that a student is able to get in between each study session. The amount of sleep a student gets in between learning material plays a huge role in memory and retention. By being able to sleep multiple nights between comprehensive material, the student is able to understand and remember the information a lot better than if they were to cram the night before. The reason why you don’t want too many nights in between during studying though, is because the brain does eventually forget information, especially if it isn’t being used on a daily basis. With that said, studying anymore than 6 days ahead of an exam can actually work against your favor as you begin to start to forget some things you learned at the very beginning.

    The other day, I was invited over to my caucasian friend’s place back in Lowell (his race is important in this context). When we stepped in through the front door, I was in the process of taking off my shoes when he told me “oh, don’t take your shoes off, we don’t do that here”. This was the first time I had never taken off my shoes inside someone’s house. I was a bit thrown back, and asked “Why? Do you not take your shoes off?, and he replied with “No, not really”. I was still a bit surprised but did not want to be disrespectful, so I walked through the house with shoes on, and could only think about how gross it was. When we walked into his furnished basement, I couldn’t believe how dirty the carpet was as it was covered in dirt stains. As we hung out a bit more, I could not process the idea that I still had my shoes on. I then had to ask “do you sleep with your shoes on?”, to which he replied with “of course, you don’t?”. I couldn’t believe it. The amount of bacteria that is on the streets and outside, and the idea of bringing that inside, and tracking it everywhere in the house seemed disgusting to me.

Lawns create the feeling of a natural environment in urban areas, offsetting the health liabilities that typically befall city residents (Irvine et al., 2003), essentially contributing to the overall well-being of the people. Urban green spaces also serve as grounds for recreation and the development of social connection. As for the presence of green spaces on campuses, studies have revealed that there is indeed a correlation between presence and use of green spaces, and perceived student quality of life (McFarland, 2008). This speaks to the fact that lawns or UGSs have vital psychological benefits to humans. Lawns also possess some ecological significance as they contribute to the conservation of biodiversity in urban settings.    

Biodiversity is an important feature in any ecosystem, and lawns are no exception. The data obtained from this study will offer some insight into the effects of common maintenance practices on lawn biodiversity in Amherst, Massachusetts, while also setting the stage for more research that could be done on the topic. The data will be a useful aid in future decisions both about how lawns should be maintained, and about how these practices can be used such that floral diversity is maintained. It can also offer a framework for efforts to slow the decline of biodiversity in green spaces, for example by highlighting which areas have the most biodiversity and how that correlates with how these areas are maintained. This can allow for individualized tailoring of maintenance practices for each lawn or green space based on the plant species that inhabit it, and also provide information about which areas could benefit from the introduction of new species to increase the floral diversity.

Beyond the ecological aspect of maintaining green spaces, there is also the psychological value that lawns have.

For our treatment, we will use liposomal delivery to insert miR-31 and an RNA sponge for miR-155 attached to a strong promoter.  To target this liposome, we will attach APB5 (ThermoFisher Scientific)- a monoclonal antibody specific for platelet derived growth factor receptor beta (PDGFRB), which is known to be a cell surface antigen of ovarian CAFs (Wintzell et al. 2012). The strong promoter we will attach the RNA sponge to is the promoter for fibroblast activation protein (FAP) which is selectively expressed in stromal fibroblasts (Zhang et al 2010). The sequence for miR-31 is AGGCAAGAUGCUGGCAUAGCUG and the sequence for miR-155 is UUAAUGCUAAUCGUGAUAGGGGUU. Both of these were found at www.mirbase.org.  We will add the sequence for miR-31 as given, and the miR-155 sponge will be the one used by Kluiver and colleagues (2012), which will be the reverse transcribed version of the complement to this RNA strand.  By inserting miR-31, the SATB2 protein will be repressed. Repression of SATB2 means that transcription of CAF genes involved in tumor epithelial to mesenchymal transition will be repressed. By inserting the miR-155 sponge, the overexpression of miR-155 will be irrelevant, because it will be sequestered. The mechanism of miR-155 upregulation in CAFs leading to tumor cell progression is unknown, however it has been shown to reverse the CAF phenotype (Mitra et al 2012.)

In 1866, John Langdon Down, physician and medical superintendent of the Earlswood Asylum in Surrey, England, noticed a remarkable resemblance among a number of his intellectually disabled patients: all of them possessed a broad, flat face, a small nose, and oval-shaped eyes. Their features were so similar, in fact, that he felt that they might easily be mistaken for children from the same family. Down did not understand the cause of their intellectual disability, but his original description faithfully records the physical characteristics of people with this genetic form of intellectual disability. In his honor, the disorder is today known as Down syndrome.