Blogs

In order to be familiar to birds’ vocalization, there are terms that one's needs to study such as:  Amplitude (maximum energy), Fundamental tone, Frequency (number of complete cycles per unit of time), Glissando (bleeding of one tone into the next), Harmonic (a tone in the series of overtones produced by a fundamental tone), Hertz (one cycle per second), Modulation (form of a sound: carrier wave), Oscillograph (a device that records oscillations as a continuous graph), Overtone , Pitch (relative position of a tone in a scale, as determined by its frequency), Resonance (intensification and prolongation of a sound), Sinusoidal waveform (y=sin x), Sonogram (display of the frequency of a sound related to time), and Tone (distinct pitch and quality).

This treatment exploits the cross-presentation function of the immune system that allows antigen-presenting cells (APCs), especially dendritic cells (DCs) to phagocytose extracellular antigens and display them with MHC class I molecules to CD8+ T cells. Typically, extracellular antigens are phagocytosed by APCs and presented through MHC class II to CD4+ T cells, while endogenous antigens are presented through MHC class I to CD8+ T cells. This ability to display extracellular (vaccine-injected) TAAs on MHC I is crucial in the activation of CD8+ T cells in killing the tumor. There are currently two routes for this mechanism of cross-presentation: cytosolic and vacuolar (Immune Response 2014). In the cytosolic route, the extracellular antigen is phagocytosed and then actively transported to the cytosol, where it is cleaved by a proteasome, transported to the ER, and loaded onto MHC class I. In the vacuolar route, the extracellular antigen is phagocytosed and then at the ER is incorporated into an early endosome with lysosomal enzymes and MHC class I, which subsequently displays the antigen on the plasma membrane (Immune Response 2014). The specific pathways involving cross-presentation remain unclear to me and requires further research. I also need to look into mechanisms of APC function, especially those of dendritic cells, so the cancer vaccine treatment will be able to work properly.

Researchers found a connection between the hormone noradrenaline and perception of images. It was found that people with higher levels of noradrenaline in their systems were able to discriminate low quality images better. What the researchers attempted to figure out was whether if noradrenaline and an effect on sensory perception and if noradrenaline improved perception of images. Noradrenaline plays a role in the late processing of the cerebral cortex. Therefore, it would determine whether the image would be brought back into the person’s memory. Typically, noradrenaline is expressed during arousal but there are more functions to the neurotransmitter that was found.

Hummingbirds have a high daily energy requirement for their size compared to other organisms including humans. The average sized human requires 2,000-2,500 kcal/day whereas a 3.5kg hummingbird requires 7.65kcal/day. If humans needed the same average intake as hummingbirds it would require about 800 can of coke in a day to meet the caloric requirements. Hummingbirds have high metabolic rates and various adaptions to make this work. They have a sufficient oxygen delivery system to tissues, rapid conversion of oxygen and nutrients to ATP, a high capacity to transport stored nutrients to fuel, and a digestive capacity to supply uptake of nutrients at sufficient rates. Hummingbirds muscle morphology is also highly adapted to suit their lifestyles. They have high capillary density to support high rates of oxygen delivery along with a high mitochondrial density.

Management and economics of energy are important for fitness. Animals allocate resources for reproduction, growth, and maintenance. R type species have short life spans and lots of reproduction while K type species have long life spans and produce few offspring that they invest a lot of energy into. The rate of energy usage is also an important consideration. The rate of energy usage determines how quickly an organism will go through their stored resources and how much food is required to get from the environment. Organisms have unique physiological and anatomical traits that help them manage energy acquisition, storage, and utilization.

The NaN1898_Bd1_70884553_Het mutation was located on the Bradi72430 gene as a point mutation converting a guanine to adenine. Through Primer 3, primers for PCR of the mutation site were identified: GGGGTTCTTGTCTGCGCTCTGGT (left) and GCACACGAGAGGAAAACGACCGC (right). The primers were for a product of 928 bases, and the mutation was 134 bases away from the left primer (Figure 1).

DNA was successfully extracted from six mutant plants and two wildtype plants. PCR of this DNA was performed with an annealing temperature of 66°C. The resulting PCR products were visualized via gel electrophoresis. Bands on the gel of PCR products diluted double distilled H2O (Figure 2) were much more prominent, indicating higher DNA content than PCR products diluted with T10E1 (Figure 3). Bands were present in lanes 2-5 and 7-8 of both gels about 3.5 cm from the wells. There were no bands in lanes 6 and 9 of both gels. Bands in lanes 2-5 (mutants 1-4) of gel 2 were the brightest and least smeared overall, so these were used for extraction and purification. Once extracted and purified, the DNA of mutants 1 proved to have the highest DNA content (Table 1). The A260/A280 ratios revealed the DNA of mutants 1 and 4 to be relatively pure, with ratios close to 2.0. DNA from mutants 2 and 3 were more contaminated. These four samples of extracted and purified DNA were sent for Sanger sequencing.

This was for the same talk at harvard. This talk was incredibly interesting and focused on how cells grow in a defined rod shape. The purpose of the talk was to explain how cells maintained a uniform width while expanding from a spherical shape to a rod shape. The organism used in the study was Bacillus subtilis, it was used because it is a rod shaped cell. The average width of the rod shaped B. subtilis is 740 nm, this value only varies by 1% and makes it an ideal organism for this study. Knowing that this organism has a uniform width shared by all individuals the question was then asked, how does this organism regulate the width of its rod shape? The way that this was tested was by changing conditions of cell growth, using antibiotic to target certain cellular mechanisms, as well as up regulating and down regulating certain genes within the rod complex (this complex is known to be associated with rod shaped growth of cells). One condition which the cells were exposed to was a salt shock, the salt causes the cells to shrink. This process was used to determine shrinking rates of the cell when mreBCD was upregulated or downregulated. Another condition cells were exposed to was providing more or less nutrients to determine which complexes would be affected by nutrient availability and how that would ultimately affect rod shaped growth. For observing the orientation of cell walls polarization microscopy was used.

The bright bands on the gel indicate that DNA was successfully extracted. This was expected, despite some worry about self complementation due to the “any th” value of 8.16 in the primer3 output. We do not know why lane number 2 on the TE gel did not show a band. We recall loading sample into this lane. It is possible that something in the DNA extraction protocol failed, so no DNA of large band size was extracted. We preferentially chose mutants from the TE gel to send for sequencing because TE stabilizes DNA. All three of the trustworthy sequence results confirmed that the mutant plants were homozygous for the NaN1793 mutation.

By looking at the gels, we decided to extract M1 from H20 because it did not show up on TE. We then chose to take M2, M6, and M7 from the TE gel. After purifying the DNA from the gel using the gel extraction protocol. The concentration of M1 was 30.2 ng/uL. The concentration of M2 was 37.3 ng/uL. The concentration of M6 is 24.1 ng/uL. The concentration of M7 is 25.1 ng/uL. The A260/280 ratios are all near 2.0. This is usually considered pure for RNA. In this case, the fact that they are consistent across all four samples is a good indicator that we have pure DNA.

Cabomba caroliniana, or better known as fanwort, is a perennial aquatic plant. Stems of the plant reach up to 10 meters and are branched. The leaves grow in pairs outward from the stem with fine texture. The stems themselves are rhizomes and leaves that reach the surface are diamond-shaped. Fanwort is native to subtropic-temperate regions of eastern north and south America. It was naturalized in the United States via aquarium trade. Plant fragments easly settle and grow through movements from different bodies of water carried by boits, fishing gear, wind, and currents. The plant is well adapt to grow in a variety of substrates and depths up to 30ft or in shallow waters less than ten feet. A variety of issues concerning ecological relationships and even impacts on humans arise as the density of the plants prevent use of different bodies of water. Furthermore, fanwort displaces native macrophytes and creates shortages of food for native fish.