WAS Primers 3.3

From Gene and Genome Analysis
Jump to: navigation, search

LENGTH OF LEFT PRIMER: 25 bp

Tm of LEFT PRIMER: 61.3 C

SEQUENCE OF LEFT PRIMER: cgcaacaacCTGCAATACACCGACG


LENGTH OF RIGHT PRIMER: 22 bp

Tm OF RIGHT PRIMER: 60.2 C

SEQUENCE OF RIGHT PRIMER: acgggcttggctcatcccatca