WFF Lab 5

From Gene and Genome Analysis
Jump to: navigation, search

Materials and Methods

In this lab we worked to find expression levels of our gene in different tissues and after being exposed to different treatments. We used the bbc.botany.utoronto.ca database to explore microarray data summarizing where our gene is expressed the most and during which stage of development. We also used genevestigator.com to search through different microarray experiments pertaining to our gene. We found five studies that showed a statistically significant change in expression of our gene. We did this by following the protocol described on pages 187-192 of the lab manual. We also looked at microarray data using the NCBI database. We found experiments that measured the expression of our gene and performed t-tests to determine if these studies showed a statistically significant difference in gene expression. We completed this task using the protocol described on pages 194-200 in the lab manual.

We designed primers for a reverse transcription PCR (RT-PCR) reaction. We used quantprime.de to find primers that cover exon borders to amplify the CDNA and not the genomic DNA. We found primers with the stated criteria, a left primer with the sequence TCGTCAAAGCATGGGTTCTGGTAG and a right primer with the sequence TCCAATAGCTGAGACGAGCTGGAG. We also designed an experiment to measure the expression levels using this PCR technique. to carryout these steps we followed the protocol from pages 201-203 of the lab manual. The experiment was performed on plants grown on media plates for one week. We created a 50 μM solution of abscisic acid dissolved in methanol and water. We sprayed this solution on eight plants and we also sprayed eight plants with a control spray consisting of water and methanol. These samples were placed in the incubator for 24 hours, we then extracted RNA samples to perform RT-PCR. We quantified the CDNA amplification results using the Nanodrop. To accomplish this we followed the protocol described on pages 205-208 in the lab manual, excluding the third task. We prepared the CDNA to be a template for quantitative PCR (qPCR). and performed the qPCR to measure the amount of expression in each sample. We did this by following the procedure described on 209-210 in the lab manual. We analyzed the results and determined the change of expression and the fold change of expression. We performed this analysis using the protocol on page 211 of the lab manual.


5.1 Microarray Resources

We used the University of Toronto Botany website to visualize the pattern of expression of our unknown gene AT3G15650 in various anatomical organs of plants. The graphical summary (Fig. 1) shows the levels of expression in organs and tissues. The tissues with more red have high expression of our gene. There is a scale for expression level on the lower left corner. We were able to investigate further in certain organs. We chose to look further into roots and found that our unknown gene is highly expressed in phloem companion cells (Fig. 2.). After we used Genevestigator to investigate array data that exists about our gene. The five experiments (Table 1) we found one experiment that unregulated our gene and four that downregulated our gene.

Figure 1. This image shows the graphical summary of array data associated with our gene.
Figure 2. This is a closeup image of the roots, specifically the phloem companion cell in a bright red color.
Table 1. This table shows five experiments and whether they upregulate or downregulate our gene, AT3G15650.



























































5.2 Statistical Analysis of Microarray Data

We used the NCBI Gene Expression Omnibus (GEO) DATABASE. We were searching through available microarray data. The seven experiments we found (Fig. 3) each had three replications of the control and experiment. We then performed a TTest for each data set to determine if there is an actual difference in the expression of our unknown gene between the two conditions. The outcome of the TTest, the p-values are represented next to each experiment.

Figure 3. This image displays seven experiments from NCBI's Gene Expression Omnibus' and the p-value outcome from a TTest.



























5.4 RNA Extraction and Quantification

We successfully isolated RNA from our experimental plant samples. Four of which were control plants and four were ABA treated plants. Using the Nanodrop we found the concentrations and absorbance at 260 nm and 280 nm for each sample (Table 1.).


Table 1. This table contains the concentrations of RNA and absorbance at 260 and 280 for each our samples (control 1-4 and ABA 1-4).

Center


5.6 Analysis of qPCR Reactions

The qPCR results show the amount of cycles it took for each sample to reach threshold. We then analyzed this data for the target gene and the housekeeping gene for both experiments. The abscisic acid experiment analysis is shown in Table 2. We calculated a fold change of 0.27 meaning a decrease in expression of our target gene when treated with abscisic acid. We also compared the average ΔCt of the treatment to the average ΔCt of the control. This comparison is seen in Figure 1 which again shows a decrease in expression of our target gene. We only possess shoot data from the salt experiment so we proceeded with the analysis of the expression of our target gene in shoots. The data analysis of this experiment is seen in Table 3. We calcuated a fold change of 4.56 which means there is an increase in target gene expression in the shoots in response to salt. We compared the average ΔCt of the control (Ms) to the average ΔCt of the salt treated samples for further analysis (Figure 2). This also shows the there was an increase in gene expression of the target gene.



Table 2. This table contains the data from the qPCR and the data analysis performed on the control and abscisic acid treated samples. The ΔCt (cycle to reach threshold) for each sample was calculated and averaged. This table shows the standard deviation of the samples and the fold change of the treated samples compared to the control samples. ABA experiment.PNG

Figure 1. This graph depicts the average ΔCt of our control samples compared to the ABA treated samples. The error bars represent the standard deviation.














Table 3. This table contains the data from the qPCR and the data analysis performed on the control (ms) and salt treated samples. The ΔCt (cycle to reach threshold) for each sample was calculated and averaged. This table shows the standard deviation of the samples and the fold change of the treated samples compared to the control samples. Shoot data.PNG

Figure 2. This graph depicts the average ΔCt of the MS control samples compared to the salt treated samples. The error bars represent the standard deviation.