NHT contig

From Gene and Genome Analysis
Jump to: navigation, search

>Contig1

TTATTTTTATTATATTATATAAATGCAATATATGTTATTATATTATTATTTGATCTCGTT

TTCACATTGAAGAAGAAACTCTTCATTACATTGGGAGAAAAAAAAAGAGGCAAAAAACCA

AAAAGGAAGATCCGAAAATTTTCCCACGAAAATCTCAGATTCTGGGGAAAAAGAAAGGAA

ATCGCCAAGCAGAGAATAAGGCAAAATTTCATTCCTATTGGAATATTTGGGCTGAGATTT

TTCTCTTTTCTTTTGGATTTGTTCAAACGATAAATCTATCTTTGGGACACAAAAAAAAAG

TTAAATTTAAGAGATCGTTTTTTATTCTT


>Contig2

TATGGAAACTCTTGTCGATACAATCATCCTCTTACTAATCTTCCACAGGGTATTATTTAT

TACAGAGACCAATTGCCTGAGAGAGTTGGACAGCCTGAC