Discussion & Conclusion for Canine Experiment

Submitted by kcapri on Thu, 05/04/2017 - 12:48

DISCUSSION & CONCLUSION

Our PCR gels did not have the best results expected. The main reason the resulting gels were inadequate were because of the instruments for running the gels. We should have loaded the samples into larger wells, but the size of the gels and number of samples were limiting. Additionally, we did not have the greatest quality of DNA samples. Some lab members did not gain as many DNA quantity or quality when samples the dogs as they could have. Another mistake was in the interpretation of the gels. The PCR technique what somewhat difficult to interpret since the different sized bands were so similar in size and the PCR products were very small (around 100-300 base pairs). Our labeling of behaviors such as  “bold” and “timid” dogs were also relative to how we view our own dogs and could contradict. All these circumstances provide us with a tough time determining exactly what dogs are which DNA samples, yet hypotheses and “best-guesses” were performed.

 

If performed again, we would do several things differently. For example, we would have less DNA samples to provide larger wells and better quality of gels. Additionally, there could be a standard to classifying each dog with a description of what classifies one as “timid” or “bold,” and other traits as well.

 

A different scenario was provided by the professor for analysis of canines. Samples H, I, and J were the professors dogs. Boots, the border collie mix, was sample H due to its long coat. The sister labrador retrievers were H and I. The comparing the MC1R sequencing of H and I lead to the belief that Sample I was the blonde or yellow coat labrador retriever named Sunny due to the fact that they have the “e” allele (Nowacka-Woszuk et al., 2012).

                

        

 

LITERATURE CITED / REFERENCES

                                       

  1. Nowacka-Woszuk, S. Salamon, A. Gorna, M. Switonski, Missense polymorphisms in the MC1R gene of the dog, red fox, arctic fox and Chinese raccoon dog. J. Anim. Breed. Genet. 130, 36-41 (2012).

 

  1. Polymerase Chain Reactions. National Center for Biotechnology Information, (2014).                    

  2. Rimbault M,  Ostrander E. A, So many doggone traits: mapping genetics of multiple phenotypes in the domestic dog. Human Molecular Genetics. 21, (2012).

 

Data & Results of Canine Experiment

Submitted by kcapri on Thu, 05/04/2017 - 11:51

DATA & RESULTS

Table 1 - DNA Isolation Results




DNA Sample

Concentration (ng/microliters)

Absorption Ratio (A260/A280)

L1

3.2

1.52

L2

5.1

2.2

M1

4.9

1.73

M2

1.8

1.22

 

Table 2 - DS1 Through DS 7 For PCR







DS #

Enzyme

SNP

Trait Association

Size (Uncut)

Size (Cut)

1

BamHI

C/T

C - low weight, short

162

142

2

BamHI

C/G

C - long coat

220

200

3

EcoRI

C/T

C - low snout ratio

152

129

4

EcoRI

C/T

C - high snout ratio

119

105

5

PstI

G/A

A - high weight, tall

134

114

6

PstI

G/A

A - low snout ratio

136

110

7

SaII

C/T

T - low weight

186

166

*We had DS-7 and our gels are featured below in Figure 1.

 

Figure 1 - DS-7 Gels of Our Lab Group

 

Table 3 - SNP Primer Designed








Dog Trait

Enzyme

Forward Primer

Reverse Primer

Size (Uncut)

WT

Mutant

Herding

AFI11

GAAACTTATTACTCTTAAGGG

GGGCAGATGGAGTTCAGTGT

150

GAAACTTATTACTGTTTAGGGATATCTGC

GAAACTTATTACTGTTTTGGGATATCTGC

 

Table 4 - Data from PCR Experiments

 

 

 

 

 

 

Table 5 - Final Results

 

 

 

 

 

 








Dog Name

Breed

Hair Color

Weight

Point

Herd

DNA Sample (Our Hypothesis)

Leia

Labrador Retriever

Black

90 Short

No

No

J

Charlie

Field Spaniel

Black

62 Long

No

No

D

Tucker

Maltese

White

8 Long

No

No

C

Abby

Poodle

White

8 Long

No

No

C

Sunny

Labrador Retriever

Blonde (Yellow)

85 Short

No

No

I

CoCo

Yorkshire Terrier

Black & Brown

12 Long

No

No

A

Saki

Shiba Inu

Red

Short

No

No

B

Brady

Dachshund Mix Bichon-Poo

Tan

28 Long

No

No

F

Boots

Border Collie Mix

Black & White

55 Long

No

Yes

H

Toby

Field Spaniel

Brown

50 long

No

No

E

Muddy Waters

German Shepherd & Native Indian Dog

Yellow with Red markings

135 Long

No

Yes

G

Pup 1

Daikon Animal Shelter -- Unknown

N/A

N/A

N/A

N/A

K

Pup 2

Daikon Animal Shelter -- Unknown

N/A

N/A

N/A

N/A

K

Koda

N/A

N/A

N/A

N/A

N/A

L

Moose

N/A

N/A

N/A

N/A

N/A

M

*N/A -- The quantity or quality of DNA samples was not able  great enough to yield any concluding results, despite performing these anyway. The DNA sample they were was therefore given at the end of the class. Also, sample K was not able to run a PCR and is not on the table 4.

 

Canine Experiment - Methods

Submitted by kcapri on Thu, 05/04/2017 - 11:49

MATERIALS & METHODS

This canine experiment took several lab periods and different protocols. Below is an overview of the protocols, with in-depth details to follow.

  1. Collection of Dog DNA Samples from Classmates Dogs

  2. DNA Isolation

  3. Designing Primers

  4. Perform PCR for DNA Sequencing for SNPs

  5. Perform PCR for DNA Sequencing for MCR1 and Our Chosen SNPs

  6. DNA Analyze - Observing the Gels and Data Collection

1. DNA Collection

We first started with needed 30 cheek swab samples of 15 dogs of different breeds and morphological traits from dogs of students in our laboratory class to observe the differences.

2. First Lab of Canine Experiment - DNA Isolation

In the first lab period involving the canine experiments, we obtained our samples of the dog DNA. Our lab group had samples M1, M2, L1, L2. We followed the protocol for isolating the DNA with QIAamp DNA mini kits from buccal swabs. We lysed the cells, the precipitated the DNA so that we could collect the DNA molecules on the spin column. Next, we washed the NDA on the spin column. After, we eluted the sample and then collected the final purified and isolated DNA. Lastly, we checked the quantity and quality of our DNA samples using a NanoDrop by observing the concentration and absorbance ratios. Our results and data collected from our samples are shown in Table 1.

3. Second Lab of Canine Experiment - Designing dCAPS PCR Primers

In this lab period, we chose the specific morphological traits of dogs that we wanted to analyze, for later use on our dog samples collected and isolated in the previous lab periods. To do this, we had the design dCAPS PCR primers since this would allow us to view which samples have which polymorphism associated with the traits -- such as D1 primer and its SNP for [C/T]. To do so, we followed the extensive protocol given by the “dCAPS PCR Primer Design Protocol” file that was provided on Moodle, and used the website “dCAPS Finder 2.0” [http://helix.wustl.edu/dcaps/dcaps.html] . Yet, before we could do this, we had to enter our SNP data according to its specific format -- which required less than 60 characters and no non-[ATCG] characters. We created a table of all our information of the seven SNPS that the professor wanted us to use (Table 2), and well as another table of the information regarding our particular SNP that we chose -- herding (Table 3).

 

4. Third Lab of Canine Experiment - DNA Sequencing / PCR of SNP Markers

In this experiment, we ran PCR experiments to help us genotype each dog according to the SNPs that we worked on the week before which include DS 1 through 7 and also two control PCR reactions as well. The controls (a positive and a negative) were to make sure that the restriction digest worked and to create a band on our gels that we could compare each sample run to. We chose our dog sample that had the highest quality of DNA from our results from the DNA isolation - which was L2 and M1 - and followed the “Biology 284 - PCR of SNP Markers” protocol for this experiment. The SNP that we were given was DS7 for low weight. Yet, when creating the 14 tubes from the DNA samples, we ran our of L2 and had to use the lower quality L1 for the rest of the tubes. At the end of the period, we turned in 7 sample tubes of L2/L1 and M1 to Dr. Loomis for DNA sequencing of the MC1R gene, which will identify the color coat of the dogs. (Her procedure is stated in the next section.)

5. Fourth Lab of Canine Experiment - DNA Sequencing / PCR of MC1R and PCR of Our Chosen SNP Markers

Dr. Loomis performed PCR on the dog DNA samples were extracted and saved for her from last week. The sequence was performed according to the protocol in Wang et al 2013, or “MC1R Canine Sequencing paper” on Moodle and also performed PCR on our certain traits or SNPs that we chose (herding). Then, they were sent off for sequencing and ExoSAP-It PCR Product Cleanup was used to remove the primers before the sequencing.

6. Fifth Lab of Canine Experiment - DNA Analysis

This lab we followed the protocol from the “Analysis of Canine DNA Sequencing” file on Moodle. We used “4Peaks” to clean up our files of the sequencing of the L and M dog samples. Then we assembled and uploaded the overlapping sequencing to “CAP3 Sequence Assembly” program with the FASTA format. After that, we uploaded our contig to Moodle and shared them with the class. After, we analysed and compared our sequences on “NCBI” by doing a Nucleotide Blast. Then, we aligned the class’ data. There were several problems with this step due to incorrect formatting. After, we compared the canine M1 and L2 sequences with mammoths, neanderthals, horses, and cats with the “Muscle” program

Journals Reflection PP

Submitted by maurabenson on Thu, 05/04/2017 - 11:35

For this assignment, we wrote about three hours a week of scientific writing about biology. From these journal entries, we were assigned to take one paragraph a week and revise it to a “perfect paragraph” and comment on three other perfect paragraphs with suggestions or revisions. Before we started this project, I thought it was going to be difficult to make the time to write in small portions over the week in order to journal. However, once starting, I found it was easy to use things from other classes that you had to write as journal entries and also if you were running out of material, it was easy to find sources to talk about for a journal. As I did the journals, I found it easier to summarize scientific information in a clear and concise manner. I found it meaningful to read other people’s perfect paragraphs to not only learn new information about biology but also learning to edit other people’s writing. While even though in some cases I had thought I had done everything I could to perfect my paragraphs, there were always some suggestions. This taught me that there is always room for improvement even when you think that there is not. In the future, when I have large projects, I will try to write small sections of it and also revise it multiple times, knowing there is always a better way to write.

Reflection on Poster

Submitted by maurabenson on Thu, 05/04/2017 - 11:19

The research project was done by choosing to do a proposal that was suggested and carrying out the methods and getting results. Those results were displayed by a poster using an advanced and reliable poster making software such as scribus. I have previously made a poster using google slides, and it was successful so I was hesitant to try another software that I hadn’t used yet. However, after learning how to use it in class, it wasn’t too complicated and doing the poster in class wasn’t that hard. It was nice to learn what parts of a scientific process were and how they get displayed in an image rather than a block of writing. I also learned how to analyze data and create charts in excel that correctly reflected the data. In the future, not only will I know how to create a poster in google slides, but I also will know how to create a poster in scribus, which is more reliable when printing to not have any formatting errors. The actual presenting and defending of our poster was a fun experience and ironically on the same day that I presented my poster for my independent study, which was also a good experience.

 

Reflection on Journal Entries

Submitted by maurabenson on Thu, 05/04/2017 - 11:18

For this assignment, we needed to write about three hours a week of scientific writing about biology. From these journal entries, we were assigned to take one paragraph a week and revise it to a “perfect paragraph” and comment on three other people’s perfect paragraphs with suggestions or revisions. Before we started this project, I thought it was going to be very difficult to make the time to write in small portions over the week in order to journal. However, once starting, I found it was easy to use things from other classes that you had to write as journal entries and also if you were running out of material, it was easy to find sources to talk about for a journal. As I did each journal, I found it easier to summarize scientific information in a clear and concise manner. I found it meaningful to read other people’s perfect paragraphs to not only learn new information about biology but also learning to edit other people’s writing. While even though in some cases I had thought I had done everything I could to perfect my paragraphs, there were always some suggestions. This taught me that there is always room for improvement even when you think that there is not. In the future, when I have large projects, I will try to write small sections of it and also revise it multiple times, knowing there is always a better way to write.

 

Reflection on Proposal

Submitted by maurabenson on Thu, 05/04/2017 - 11:18

In the research proposal, we were to create a potential methods for an experiment pertaining to moss in groups. I had never written a research proposal before, nor written a paper in a group so I was not sure how to do this. I thought that learning how to do a review of primary literature was useful because reading scientific papers that are peer reviewed is something that I will have to do in any scientific career. Creating a potential methods was a frustrating experience due to being steered in many directions, but putting in the work we eventually were able to come up with a cohesive plan and actually carry out our methods to test it. Writing a paper in a group is hard due to the voice changing frequently but learning to come together with others was an important skill. Our particular project took many twists and turns from the beginning of the assignment to the final product, but that is usually the case with writing and it is important to realize that. Having our group’s project picked for the class as the most persuasive was a good feeling of accomplishment, even though people were deterred from actually carrying out our methods. 

Research Project Reflection

Submitted by kmichaud on Wed, 05/03/2017 - 17:57

Since we had put in so much time and energy into the research component of our topic, our research project came together smoothly. After my initial trepidation of performing the methods, I was happily surprised that our whole procedure was complete in four days. Collection and desiccation of the samples went quickly, and rehydration was accomplished in 24 hours. This was partly so easy because I had access to materials in my own research laboratory and was able to use our incubator for the samples. Once we had collected and analyzed our data, which was arguably the most strenuous part of the project, we were able to draw some conclusions from our figures. The most time consuming part was certainly working with PowerPoint to format the layout in an attractive way while fitting all of the relevant text. Looking back, I do wish that I had enough time to learn how to properly use Scribus, but it was simply a time crunch to learn a new software while organizing the components of the poster. Our group was very proactive in how efficiently we organized the information and displayed it on the poster, which resulted in how seamlessly the final product was produced. Again, our groups cohesiveness and willingness to meet outside of class made this project far more feasible than I originally predicted. In the future, I plan to learn how to use Scribus to create my posters and will continue to focus on formatting that is visually pleasing and cohesive. 

journal

Submitted by jiadam on Wed, 05/03/2017 - 14:29

The Methods project was one of the first project we started on and I have to admit I was not entirely sure what to expect or what was expected of me. I’ve written methods sections before, but it was usually just the actual procedure in my own words. Writing methods for the moss project provided its challenges because I was not sure what the most important things to write about where and what details did I need to include.

I wrote about the research I did before actually going out to look for moss, but that was irrelevant and I failed to mention details about the orientation and scaling of the figures which proved to be critical in the differences between the original and replicated figure. When it came time to do the project and actually write the methods, I succeed in some aspect and did not succeed in others. While I believed I had a grasp understanding of the difference between inferences and differences, my writing showed the latter and my actual methods provided irrelevant detail. I did write a results section with a lot of differences and the organization was good, but the organization for the discussion section was not.

Research Proposal Reflection

Submitted by kmichaud on Wed, 05/03/2017 - 12:52

I was honestly frustrated at the beginning of this project, because I did not foresee that I would be able to put in enough time in my hectic schedule to perform a significant experiment on a topic that I knew next to nothing about. After jumping in with my group members, I found that desiccation tolerance would be a topic that would be relatively simple to manipulate with limited supplies and would be a biologically relevant question. As I considered how other groups had successfully desiccated moss specimen, our project became more realistic and it appeared that we could accomplish our methods in a week with minimal purchasing. I think a major contributing factor to how smoothly our proposal came together was how willing my groupmates were to meeting regularly to discuss how we would put the proposal together and who would accomplish which writing parts. After our presentation, we were all rather surprised that our project was not selected to be the class project since we had become rather attached to our design and topic. Following the proposals, we chose to utilize our idea and methodology in our manipulative experiment since we had successfully convinced ourselves that it was the most feasible and important project. Gradually, I realized that the project was more realistic than I previously thought and the proposal was actually quite successful. 

Pages

Subscribe to Writing in Biology RSS