You are here

kcapri's blog

Discussion & Conclusion for Canine Experiment

Submitted by kcapri on Thu, 05/04/2017 - 12:48

DISCUSSION & CONCLUSION

Our PCR gels did not have the best results expected. The main reason the resulting gels were inadequate were because of the instruments for running the gels. We should have loaded the samples into larger wells, but the size of the gels and number of samples were limiting. Additionally, we did not have the greatest quality of DNA samples. Some lab members did not gain as many DNA quantity or quality when samples the dogs as they could have. Another mistake was in the interpretation of the gels. The PCR technique what somewhat difficult to interpret since the different sized bands were so similar in size and the PCR products were very small (around 100-300 base pairs). Our labeling of behaviors such as  “bold” and “timid” dogs were also relative to how we view our own dogs and could contradict. All these circumstances provide us with a tough time determining exactly what dogs are which DNA samples, yet hypotheses and “best-guesses” were performed.

 

If performed again, we would do several things differently. For example, we would have less DNA samples to provide larger wells and better quality of gels. Additionally, there could be a standard to classifying each dog with a description of what classifies one as “timid” or “bold,” and other traits as well.

 

A different scenario was provided by the professor for analysis of canines. Samples H, I, and J were the professors dogs. Boots, the border collie mix, was sample H due to its long coat. The sister labrador retrievers were H and I. The comparing the MC1R sequencing of H and I lead to the belief that Sample I was the blonde or yellow coat labrador retriever named Sunny due to the fact that they have the “e” allele (Nowacka-Woszuk et al., 2012).

                

        

 

LITERATURE CITED / REFERENCES

                                       

  1. Nowacka-Woszuk, S. Salamon, A. Gorna, M. Switonski, Missense polymorphisms in the MC1R gene of the dog, red fox, arctic fox and Chinese raccoon dog. J. Anim. Breed. Genet. 130, 36-41 (2012).

 

  1. Polymerase Chain Reactions. National Center for Biotechnology Information, (2014).                    

  2. Rimbault M,  Ostrander E. A, So many doggone traits: mapping genetics of multiple phenotypes in the domestic dog. Human Molecular Genetics. 21, (2012).

 

Data & Results of Canine Experiment

Submitted by kcapri on Thu, 05/04/2017 - 11:51

DATA & RESULTS

Table 1 - DNA Isolation Results




DNA Sample

Concentration (ng/microliters)

Absorption Ratio (A260/A280)

L1

3.2

1.52

L2

5.1

2.2

M1

4.9

1.73

M2

1.8

1.22

 

Table 2 - DS1 Through DS 7 For PCR







DS #

Enzyme

SNP

Trait Association

Size (Uncut)

Size (Cut)

1

BamHI

C/T

C - low weight, short

162

142

2

BamHI

C/G

C - long coat

220

200

3

EcoRI

C/T

C - low snout ratio

152

129

4

EcoRI

C/T

C - high snout ratio

119

105

5

PstI

G/A

A - high weight, tall

134

114

6

PstI

G/A

A - low snout ratio

136

110

7

SaII

C/T

T - low weight

186

166

*We had DS-7 and our gels are featured below in Figure 1.

 

Figure 1 - DS-7 Gels of Our Lab Group

 

Table 3 - SNP Primer Designed








Dog Trait

Enzyme

Forward Primer

Reverse Primer

Size (Uncut)

WT

Mutant

Herding

AFI11

GAAACTTATTACTCTTAAGGG

GGGCAGATGGAGTTCAGTGT

150

GAAACTTATTACTGTTTAGGGATATCTGC

GAAACTTATTACTGTTTTGGGATATCTGC

 

Table 4 - Data from PCR Experiments

 

 

 

 

 

 

Table 5 - Final Results

 

 

 

 

 

 








Dog Name

Breed

Hair Color

Weight

Point

Herd

DNA Sample (Our Hypothesis)

Leia

Labrador Retriever

Black

90 Short

No

No

J

Charlie

Field Spaniel

Black

62 Long

No

No

D

Tucker

Maltese

White

8 Long

No

No

C

Abby

Poodle

White

8 Long

No

No

C

Sunny

Labrador Retriever

Blonde (Yellow)

85 Short

No

No

I

CoCo

Yorkshire Terrier

Black & Brown

12 Long

No

No

A

Saki

Shiba Inu

Red

Short

No

No

B

Brady

Dachshund Mix Bichon-Poo

Tan

28 Long

No

No

F

Boots

Border Collie Mix

Black & White

55 Long

No

Yes

H

Toby

Field Spaniel

Brown

50 long

No

No

E

Muddy Waters

German Shepherd & Native Indian Dog

Yellow with Red markings

135 Long

No

Yes

G

Pup 1

Daikon Animal Shelter -- Unknown

N/A

N/A

N/A

N/A

K

Pup 2

Daikon Animal Shelter -- Unknown

N/A

N/A

N/A

N/A

K

Koda

N/A

N/A

N/A

N/A

N/A

L

Moose

N/A

N/A

N/A

N/A

N/A

M

*N/A -- The quantity or quality of DNA samples was not able  great enough to yield any concluding results, despite performing these anyway. The DNA sample they were was therefore given at the end of the class. Also, sample K was not able to run a PCR and is not on the table 4.

 

Canine Experiment - Methods

Submitted by kcapri on Thu, 05/04/2017 - 11:49

MATERIALS & METHODS

This canine experiment took several lab periods and different protocols. Below is an overview of the protocols, with in-depth details to follow.

  1. Collection of Dog DNA Samples from Classmates Dogs

  2. DNA Isolation

  3. Designing Primers

  4. Perform PCR for DNA Sequencing for SNPs

  5. Perform PCR for DNA Sequencing for MCR1 and Our Chosen SNPs

  6. DNA Analyze - Observing the Gels and Data Collection

1. DNA Collection

We first started with needed 30 cheek swab samples of 15 dogs of different breeds and morphological traits from dogs of students in our laboratory class to observe the differences.

2. First Lab of Canine Experiment - DNA Isolation

In the first lab period involving the canine experiments, we obtained our samples of the dog DNA. Our lab group had samples M1, M2, L1, L2. We followed the protocol for isolating the DNA with QIAamp DNA mini kits from buccal swabs. We lysed the cells, the precipitated the DNA so that we could collect the DNA molecules on the spin column. Next, we washed the NDA on the spin column. After, we eluted the sample and then collected the final purified and isolated DNA. Lastly, we checked the quantity and quality of our DNA samples using a NanoDrop by observing the concentration and absorbance ratios. Our results and data collected from our samples are shown in Table 1.

3. Second Lab of Canine Experiment - Designing dCAPS PCR Primers

In this lab period, we chose the specific morphological traits of dogs that we wanted to analyze, for later use on our dog samples collected and isolated in the previous lab periods. To do this, we had the design dCAPS PCR primers since this would allow us to view which samples have which polymorphism associated with the traits -- such as D1 primer and its SNP for [C/T]. To do so, we followed the extensive protocol given by the “dCAPS PCR Primer Design Protocol” file that was provided on Moodle, and used the website “dCAPS Finder 2.0” [http://helix.wustl.edu/dcaps/dcaps.html] . Yet, before we could do this, we had to enter our SNP data according to its specific format -- which required less than 60 characters and no non-[ATCG] characters. We created a table of all our information of the seven SNPS that the professor wanted us to use (Table 2), and well as another table of the information regarding our particular SNP that we chose -- herding (Table 3).

 

4. Third Lab of Canine Experiment - DNA Sequencing / PCR of SNP Markers

In this experiment, we ran PCR experiments to help us genotype each dog according to the SNPs that we worked on the week before which include DS 1 through 7 and also two control PCR reactions as well. The controls (a positive and a negative) were to make sure that the restriction digest worked and to create a band on our gels that we could compare each sample run to. We chose our dog sample that had the highest quality of DNA from our results from the DNA isolation - which was L2 and M1 - and followed the “Biology 284 - PCR of SNP Markers” protocol for this experiment. The SNP that we were given was DS7 for low weight. Yet, when creating the 14 tubes from the DNA samples, we ran our of L2 and had to use the lower quality L1 for the rest of the tubes. At the end of the period, we turned in 7 sample tubes of L2/L1 and M1 to Dr. Loomis for DNA sequencing of the MC1R gene, which will identify the color coat of the dogs. (Her procedure is stated in the next section.)

5. Fourth Lab of Canine Experiment - DNA Sequencing / PCR of MC1R and PCR of Our Chosen SNP Markers

Dr. Loomis performed PCR on the dog DNA samples were extracted and saved for her from last week. The sequence was performed according to the protocol in Wang et al 2013, or “MC1R Canine Sequencing paper” on Moodle and also performed PCR on our certain traits or SNPs that we chose (herding). Then, they were sent off for sequencing and ExoSAP-It PCR Product Cleanup was used to remove the primers before the sequencing.

6. Fifth Lab of Canine Experiment - DNA Analysis

This lab we followed the protocol from the “Analysis of Canine DNA Sequencing” file on Moodle. We used “4Peaks” to clean up our files of the sequencing of the L and M dog samples. Then we assembled and uploaded the overlapping sequencing to “CAP3 Sequence Assembly” program with the FASTA format. After that, we uploaded our contig to Moodle and shared them with the class. After, we analysed and compared our sequences on “NCBI” by doing a Nucleotide Blast. Then, we aligned the class’ data. There were several problems with this step due to incorrect formatting. After, we compared the canine M1 and L2 sequences with mammoths, neanderthals, horses, and cats with the “Muscle” program

Urushiol Perfect Paragraph 2

Submitted by kcapri on Sun, 04/30/2017 - 16:52

When discussing the amount or concentration of urushiol in plants, it does depend on the growth conditions and the particular season. A study performed by Japanese researchers indicated the percent compositions of urushiol depend on its unsaturated bonds in Japanese, Korean, and Chinese Rhus vernicifera (lacquer trees). Researchers found that the most abundant urushiol was the triene urushiol at 71 percent, while the next most abundant was mono-urushiol at 14-16 percent, and diene urushiol at 5-8 percent concentration (Tetsuo et al., 2002).

Genetics Lab Paper Introduction

Submitted by kcapri on Sun, 04/30/2017 - 16:50

INTRODUCTION

Genetics is an important subject in biology to understand and learn for a number of reasons. It can help us learn not only more about ourselves as humans, but more about our favorite furry friends -- the canine. Dogs and humans have been friends for a while now. There are over 350 domestic dog breeds that have been selected artificially thanks to humans in the last 200 to 300 years (Rimbault and Ostrander, 2012). This artificial selection has caused breeds with varied traits such as body size, leg length, and skull shape. These small variances are a result of hundreds of genes. An example of a gene that codes for a phenotypic dog trait is the melanocortin receptor type 1 (MC1R) gene that codes for coat color. While many genes do control coat color, MC1R is one we observed.

The experiment aided in learning about the genetic mechanisms that control morphological traits that define certain breeds. In order to do this, we performed several different laboratory experiments over several different weeks. First, we isolated the canine DNA samples that were collected from the dogs’ of the classmates.  We then decided on certain primers to observe different SNP markers, or mutations in the genome, that result in specific traits of dog breeds such as anything from their trainability, excitability, to their snout ratio. Once we designed these primers and purchased them, we performed a number of Polymerase Chain Reaction (PCR) runs on the dog DNA samples in order to analyze the traits of the different dogs and try to classify them. PCR was developed in the 1980’s by Kary Mullis and uses the ability of DNA polymerases to synthesize a new strand and uses a primer to make it possible to delineate a specific region of a template strand and amplify it (“Polymerase Chain Reactions,” 2014). By doing this amplification, we can sequencing DNA and learn more about certain traits, as done in this laboratory report.

 

Genetics Lab Paper Abstract

Submitted by kcapri on Sun, 04/30/2017 - 16:49

Investigation of Breed-Defining Traits of Canines Through DNA Isolation, Sequencing, and Analysis

 

ABSTRACT

Through several different procedures involving DNA samples taken from 15 dogs, we were able to analyze the unique morphological variances in dog breeds that define them. This included analyzing polymorphisms or SNPs in the genome that lead to traits such as low snouth ratio, high weight and tall height, short coat, and even trait behaviors like pointing or herding. These procedures included DNA collection, isolation, primer design, polymerization chain reaction (PCR) runs, and DNA sequencing and analysis. The results allowed us to create hypotheses of which DNA samples matched which dog breeds.

 

Urushiol Paper 6

Submitted by kcapri on Sun, 04/30/2017 - 16:48

Research and experiments involving urushiol are still continuing today. In 2012, researchers at Duke University engineered a molecule that reacts with urushiol and creates a fluorescent glow under ultraviolet light (Braslau et al., 2013). This can help campers, hikers, and other outdoor recreationists identify plants containing urushiol and prevent urushiol dermatitis. Studying urushiol and trying to understand its synthesis, storage, release, and impacts of humans and the environments can lead to other conclusions and discoveries in other fields. Duke University conducted another study of urushiol over a six-year period and discovered an increase in poison ivy growth when carbon dioxide was increased in their environment (Mohan et al., 2006). Additionally, the poison ivy plant used more of its energy on urushiol production in increased carbon dioxide environments than in lesser ones (Mohan et al., 2006). Knowing information like this can help researchers understand and infer what might happen as carbon dioxide levels increase globally. Not only this, but researching poison ivy, oak, and other plants with urushiol can aid in better the understanding of the human immune system and possibly help treat tumor cells. Recent studies suggest that urushiol induces cell growth inhibition as well as cell apoptosis by a specific pathway called p53-dependent pathway, which could be important in future cancer research (Kim et al., 2013). Examples like these studies demonstrate the importance of urushiol research and understanding for the future. Furthermore, experiments like these illustrate the importance of plants in general and understanding their physiology because they impact not only the earth, where we call home, and the animals around us, but humans as a whole.

 

Urushiol Discussion 5

Submitted by kcapri on Sun, 04/30/2017 - 16:47

A dermatitis reaction due to urushiol can happen through direct contact (touching the bruised/damaged plant directly), indirect contact (touching a glove or piece of clothing with urushiol on it), or inhalation due to the burning of a urushiol-containing plant (Ewing, 2015). When urushiol touches the human skin, tiny chemicals called haptens are secreted into your body and skin-proteins called antigens are activated and adhere to the urushiol chemical (Ewing, 2015). Next, Langerhans cells then adheres to the antigen with the haptens. It will then recognize that the molecule is foreign and send signals to helper T- cells in the body. If it is the first contact of urushiol, the helper T-cell will remember the urushiol for the next contact and not react until the second exposure. The first sensitization of urushiol causes the Langerhans cells with the antigen to migrate to the lymph nodes to present it to the T-lymphocytes for recognition and reaction during the second exposure (Rietschel and Fowler, 2008).  If one is exposed again and is allergic, the helper T-cells will release cytokines and chemokines that cause the dermatitis reaction of the skin. Then, they signal macrophages, T-lymphocytes, and more t-helper cells to that all can eliminate the Langerhans cell with the foreign hapten urushiol chemical (Ewing, 2015). Yet, these fighters also kill healthy cells as well. The dermatitis reaction is dependent on the amount of urushiol that has secreted into the bloodstream, how susceptible one is to urushiol, and any past contact with urushiol. It could take up to 24 hours to a week for people who have never been exposed for dermatitis to show up on human skin (Ewing, 2015).

The rash caused by urushiol is non-lethal and only in rare cases has caused death. It can also be caused year-round since urushiol is stored all year, as previously stated. Therefore, it is wise for humans not to touch dead or dried poison ivy plants during the winter months as well. Symptoms caused by urushiol can be alleviated by creams such as calamine lotion, hormones, and steroids now. In the past, different cultures have tried applying anything from crab meat, banana juices, shoe polish, and marshmallows onto the rash (Dickinson et al., 2013). Additionally, acupuncture has also been an option to relieve dermatitis pain.

Besides causing a painfully itchy dermatitis reaction, Urushiol can also serve beneficial purposes. It can serve as a sealant for the plants’ wounds, and thus increases water retention in plants when damaged, and retardation of growth of infectious fungal and bacterial spores (Mullins, 2015). Urushiol was used by Native American tribes and traditional Chinese culture for medical purposes because of its antioxidant, antimicrobial, and antigenic properties (Dickinson et al., 2013). Some also believe in the treatment of osteoarthritis by urushiol to alleviate pain. Though now, the sensitive nature of urushiol to oxidation and polymerization restricts its therapeutic use. Other uses of urushiol include components in face paint, certain types of honey such as poison oak honey, and even erosion-barriers.

In order to prevent dermatitis and remove urushiol-contact from human reach, several methods have been implemented. Different chemicals sprays can be added to lawns and areas to kill poison ivy. Another method of urushiol removal that may be more environmental-friendly are goats. There are several companies that can be hired to bring goats that eat poison ivy and urushiol-containing plants (Dickinson et al., 2013).

 

Plant Physiology - Urushiol 4

Submitted by kcapri on Sun, 04/30/2017 - 16:46

Plants are impeccable chemists and it is critical to understand the chemical traits of urushiol before discussing synthesis. This toxin is a mixture of alkyl catechols that is comprised of a 1,2 dihydroxybenzene ring (Flank, 1986). It is a phenolic compound, which means it consists of a benzene ring with a long hydrophobic side chain consisting of a large number of carbons on the carbon-3 position of the benzene ring, as shown in Figure 2. Depending of the specific plant containing urushiol, the amount of carbons in the side chain differs. While poison ivy and sumac have 15 carbons on its chain, poison oak has 17 carbons.

Urushiol is synthesized in the secretory cells of the resin ducts by the shikimic acid pathway. Resin components are derived from carbohydrates that are produced from photosynthesis.  As shown from Figure 3, Protocatechuic acid is a product of the shikimic acid pathway and then used to produce urushiol (Caspi et al., 2013).

When discussing the amount or concentration of urushiol in plants, it does depend on the growth conditions and the particular season. A study performed by Japanese researchers indicated the percentage compositions of urushiol depending on its unsaturated bonds in Japanese, Korean, and Chinese Rhus vernicifera (lacquer trees). Researchers found that the most abundant urushiol was the triene urushiol at 71%, while the next most abundant was mono-urushiol at 14-16%, and diene urushiol at 5-8% concentration (Tetsuo et al., 2002).

Urushiol is vital to research and understand for a number of reasons. It is believed that urushiol’s purpose may be a defense mechanism for plants. When humans touch plants such as poison ivy are damaged, a skin dermatitis reaction due to urushiol results. Yet, it is interesting that while humans are allergic to urushiol, most other animals are not. Besides humans, only guinea pigs, rabbits, mice, and sheep have slight sensitivities to this toxin  (Dickinson et al., 2013). Furthermore, it is also interesting to note that humans came late to North America, after poison ivy and urushiol were already present and prospering on the land, which also conflicts with this defense mechanism theory (Senchina, 2006).

There are several impacts urushiol has on humans and the environment -- both positive and negative. To start with harmful impacts on humans, there is the dermatitis reaction caused by urushiol when poison ivy tissue is damaged and it is released and in contact with humans. Some people are so sensitive to urushiol that only 2 micrograms on human skin can cause a reaction (Epstein et al., 1974).  Around 80-90% of adult American individuals were reported to have a dermatitis rash when exposed to  50 micrograms of urushiol (Epstein et al, 1974). Additionally, urushiol can be difficult to wash off clothing and skin, so it can be spread by touching an urushiol-contaminated item. It is important to wash all skin and articles of clothing that may have come into contact right away to prevent the spread.

 

Perfect Paragraph - Urushiol 1

Submitted by kcapri on Fri, 04/21/2017 - 15:11

Poison ivy is a member of the Anacardiaceae family. Its members include cashews, sumac, and mangos, all of which contain urushiol as well (Aguilar-Ortigoza, 2003). Poison ivy’s history in North America dates back to the early 17th century, and possibly even before that. The first published records of poison ivy in North America date to 1609 in Captain John Smith’s writings about the New World after his voyage from England (Armstrong and Epstein, 2011).  Despite this fact, urushiol was first isolated quite recently in the 1920’s by a Japanese chemist named Rikou Majima (Boyd and Rucker, 2013). He named urushiol after the term urushi, the Japanese name for lacquer tree, due to its coloring. Urushiol is colorless until the allergen is exposed to oxygen in the air, and then turns a dark brown or black color - which gives it the same coloring as lacquer that is used for finishing wood (Boyd and Rucker, 2013).  

Pages

Subscribe to RSS - kcapri's blog